ID: 997579135_997579143

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 997579135 997579143
Species Human (GRCh38) Human (GRCh38)
Location 5:135006189-135006211 5:135006235-135006257
Sequence CCTGCGTGGATTGTGCTTAAAGA GGGTCCTTTATGGGGCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46} {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!