ID: 997579139_997579147

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 997579139 997579147
Species Human (GRCh38) Human (GRCh38)
Location 5:135006218-135006240 5:135006270-135006292
Sequence CCAACTCTAGCTGTCATGGGTCC TTCCTCCACTGCTGCTCTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66} {0: 1, 1: 0, 2: 2, 3: 21, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!