ID: 997582943_997582954

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 997582943 997582954
Species Human (GRCh38) Human (GRCh38)
Location 5:135028619-135028641 5:135028655-135028677
Sequence CCAACCCGGAGTGGGAAGTGGGA CAGGTGTGAGGTCCGCGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 155} {0: 1, 1: 0, 2: 2, 3: 12, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!