ID: 997583609_997583626

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 997583609 997583626
Species Human (GRCh38) Human (GRCh38)
Location 5:135031922-135031944 5:135031970-135031992
Sequence CCCTCCACTTTCTTCTCCTCAGG GCACAACACAGCCGGGTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 568} {0: 1, 1: 0, 2: 1, 3: 11, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!