ID: 997584776_997584788

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 997584776 997584788
Species Human (GRCh38) Human (GRCh38)
Location 5:135037833-135037855 5:135037870-135037892
Sequence CCCCAATAAAAGCTCCCGTTTCT TACTGGGTAAGTGGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102} {0: 1, 1: 0, 2: 4, 3: 29, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!