ID: 997587015_997587022

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 997587015 997587022
Species Human (GRCh38) Human (GRCh38)
Location 5:135049220-135049242 5:135049237-135049259
Sequence CCTTCCACTCTCTGGTGGGCCTG GGCCTGGGATGGGTGGAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 43, 4: 377} {0: 1, 1: 0, 2: 6, 3: 107, 4: 1143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!