ID: 997605189_997605194

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 997605189 997605194
Species Human (GRCh38) Human (GRCh38)
Location 5:135170202-135170224 5:135170228-135170250
Sequence CCTGCAGTTCTCCTTCGAGGGGG CTTTGAGAGGAGGTGAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101} {0: 1, 1: 0, 2: 1, 3: 14, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!