ID: 997612940_997612945

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 997612940 997612945
Species Human (GRCh38) Human (GRCh38)
Location 5:135227840-135227862 5:135227885-135227907
Sequence CCTGCCAGCTGTCTGCTCTGCTC GTCACAGAGCTACAGTCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 469} {0: 1, 1: 0, 2: 1, 3: 17, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!