ID: 997624956_997624967

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 997624956 997624967
Species Human (GRCh38) Human (GRCh38)
Location 5:135325226-135325248 5:135325273-135325295
Sequence CCCTCTAGAAACTGGGGATGGTT GCCCCTTGCAGGCCTGGCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 199} {0: 1, 1: 0, 2: 0, 3: 42, 4: 1215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!