ID: 997625239_997625246

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 997625239 997625246
Species Human (GRCh38) Human (GRCh38)
Location 5:135326891-135326913 5:135326915-135326937
Sequence CCCCAAAACTGGCTTCAAGCTGT CCGTCCACAGAGGCTGGCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 33, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!