ID: 997654535_997654547

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 997654535 997654547
Species Human (GRCh38) Human (GRCh38)
Location 5:135545396-135545418 5:135545417-135545439
Sequence CCCAGGGAAACCAGGCCCCTGTG TGGCTGCCTGGGGATGGCGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 16, 3: 145, 4: 1093}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!