ID: 997679315_997679317

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 997679315 997679317
Species Human (GRCh38) Human (GRCh38)
Location 5:135738160-135738182 5:135738209-135738231
Sequence CCTTGGGGAGTGAATCTTGAGCA ATCAAGTGCACTCATTCCCGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!