ID: 997682443_997682445 |
View in Genome Browser |
Spacer: -8 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 997682443 | 997682445 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:135765867-135765889 | 5:135765882-135765904 |
| Sequence | CCCACATTGCAGGGGGCATACAC | GCATACACCCTCCTGTGTTATGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 1, 2: 9, 3: 108, 4: 553} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||