ID: 997704651_997704653

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 997704651 997704653
Species Human (GRCh38) Human (GRCh38)
Location 5:135936735-135936757 5:135936759-135936781
Sequence CCATGTAGTATTACAAATTTTTC GTAACTTCCTTTACTAGATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 319} {0: 1, 1: 0, 2: 0, 3: 15, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!