ID: 997717003_997717009

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 997717003 997717009
Species Human (GRCh38) Human (GRCh38)
Location 5:136049849-136049871 5:136049881-136049903
Sequence CCCTGGCCAGAAACAGGGAGAGT GAATAGCCAAGGCCAGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 218} {0: 1, 1: 0, 2: 1, 3: 50, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!