ID: 997727509_997727512

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 997727509 997727512
Species Human (GRCh38) Human (GRCh38)
Location 5:136133531-136133553 5:136133552-136133574
Sequence CCTGGTTTCTGCCACTTGCCATG TGTCAGTTTTCACCACTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 269} {0: 1, 1: 0, 2: 1, 3: 21, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!