ID: 997737769_997737774

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 997737769 997737774
Species Human (GRCh38) Human (GRCh38)
Location 5:136227080-136227102 5:136227121-136227143
Sequence CCTGAGTGTAGTTTGTAGGAGGT TCTGGGGTAGACTTAAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97} {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!