ID: 997763656_997763659

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 997763656 997763659
Species Human (GRCh38) Human (GRCh38)
Location 5:136476416-136476438 5:136476433-136476455
Sequence CCTCTTTCTCTATCTTATGGAAT TGGAATAGTGCCAATGGGATTGG
Strand - +
Off-target summary {0: 10, 1: 234, 2: 403, 3: 451, 4: 1834} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!