ID: 997782008_997782014

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 997782008 997782014
Species Human (GRCh38) Human (GRCh38)
Location 5:136668083-136668105 5:136668118-136668140
Sequence CCAAGAATCAGTCTGCCTGGACC TGCCAGCGTATGCCACCCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!