ID: 997817699_997817702

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 997817699 997817702
Species Human (GRCh38) Human (GRCh38)
Location 5:137034600-137034622 5:137034618-137034640
Sequence CCTGTTTTATAGCACAGAAAACT AAACTCGGGTTGTCTCAGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 2, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!