ID: 997818347_997818357

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 997818347 997818357
Species Human (GRCh38) Human (GRCh38)
Location 5:137039554-137039576 5:137039602-137039624
Sequence CCTGCCACCTCTCTGGCTCTCCT GTCCCACGCCCCCATGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 36, 3: 119, 4: 726} {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!