ID: 997822069_997822080

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 997822069 997822080
Species Human (GRCh38) Human (GRCh38)
Location 5:137075314-137075336 5:137075365-137075387
Sequence CCCCAGTGGCTTGCCACTCTCAG TCCCGCTAGAGGGCGGCTCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!