ID: 997826562_997826573

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 997826562 997826573
Species Human (GRCh38) Human (GRCh38)
Location 5:137111913-137111935 5:137111948-137111970
Sequence CCCCCATTCATCTGTGAATCCCT GAAAAGAACAGTGCCTTATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 263} {0: 1, 1: 0, 2: 1, 3: 17, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!