ID: 997834693_997834696

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 997834693 997834696
Species Human (GRCh38) Human (GRCh38)
Location 5:137182751-137182773 5:137182782-137182804
Sequence CCCTGAGCTAAAGGTCTTCACTT GAAGTGGCCACAGTACCATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!