ID: 997865644_997865650

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 997865644 997865650
Species Human (GRCh38) Human (GRCh38)
Location 5:137460384-137460406 5:137460427-137460449
Sequence CCAGGTCAAGGTACGGGATAAGG TAGGGAACACAGAAGAGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46} {0: 1, 1: 0, 2: 2, 3: 19, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!