ID: 997890144_997890146

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 997890144 997890146
Species Human (GRCh38) Human (GRCh38)
Location 5:137668831-137668853 5:137668847-137668869
Sequence CCATGGAAATCAGCAAATGAATC ATGAATCAACAGATGAATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 350} {0: 1, 1: 0, 2: 2, 3: 46, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!