ID: 997905219_997905223

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 997905219 997905223
Species Human (GRCh38) Human (GRCh38)
Location 5:137809557-137809579 5:137809603-137809625
Sequence CCGCCATCATTTGTGGCAAAGAA AGGCAAACAGCAGTGATGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 444} {0: 1, 1: 0, 2: 1, 3: 126, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!