ID: 997932150_997932158

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 997932150 997932158
Species Human (GRCh38) Human (GRCh38)
Location 5:138081644-138081666 5:138081676-138081698
Sequence CCTATTTTCCCCAAGCAGAGAGG AATCAAAGGAAGAGAGCTTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 41, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!