ID: 997956874_997956879

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 997956874 997956879
Species Human (GRCh38) Human (GRCh38)
Location 5:138285712-138285734 5:138285745-138285767
Sequence CCAGAAGGGCAATCTGCTCCCGC CCCCTTCCTGCACTTTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 86} {0: 1, 1: 0, 2: 3, 3: 20, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!