ID: 997956876_997956879

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 997956876 997956879
Species Human (GRCh38) Human (GRCh38)
Location 5:138285731-138285753 5:138285745-138285767
Sequence CCGCAGCTGCCGCTCCCCTTCCT CCCCTTCCTGCACTTTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 63, 4: 670} {0: 1, 1: 0, 2: 3, 3: 20, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!