ID: 997962768_997962777

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 997962768 997962777
Species Human (GRCh38) Human (GRCh38)
Location 5:138335207-138335229 5:138335237-138335259
Sequence CCAGCCAGCCTCTGCAGGGCAGA AGGGGTGTGTTTTCTATTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 412} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!