|
Left Crispr |
Right Crispr |
| Crispr ID |
997962768 |
997962778 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:138335207-138335229
|
5:138335253-138335275
|
| Sequence |
CCAGCCAGCCTCTGCAGGGCAGA |
TTCCTGGTTCTTTTTATGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 5, 3: 51, 4: 412} |
{0: 1, 1: 0, 2: 11, 3: 76, 4: 428} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|