ID: 997964835_997964846

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 997964835 997964846
Species Human (GRCh38) Human (GRCh38)
Location 5:138348689-138348711 5:138348726-138348748
Sequence CCTCAGAGGCTCCTCCCTATCTC CTAGGCTACCAGGTCTCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 262} {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!