ID: 997965478_997965484

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 997965478 997965484
Species Human (GRCh38) Human (GRCh38)
Location 5:138352872-138352894 5:138352889-138352911
Sequence CCTCGGCTCCCGCGGCGGCAGCG GCAGCGGCGAGCGGAGATCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 426} {0: 1, 1: 0, 2: 2, 3: 11, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!