ID: 997973682_997973687

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 997973682 997973687
Species Human (GRCh38) Human (GRCh38)
Location 5:138425652-138425674 5:138425665-138425687
Sequence CCTTGAATAATAAATTATATTCT ATTATATTCTGGGGCATAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 691} {0: 1, 1: 0, 2: 1, 3: 27, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!