ID: 997976835_997976853

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 997976835 997976853
Species Human (GRCh38) Human (GRCh38)
Location 5:138445891-138445913 5:138445941-138445963
Sequence CCAGTGGCCACTCTTCTGGAAGG CTGTGGGGGTTGAGGGTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 289} {0: 1, 1: 0, 2: 5, 3: 57, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!