ID: 997981849_997981858

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 997981849 997981858
Species Human (GRCh38) Human (GRCh38)
Location 5:138472591-138472613 5:138472616-138472638
Sequence CCTTCCACCTTCCCCCTATTCAG CCGCCCCTATCCCCCAGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 422} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!