ID: 997982217_997982222

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 997982217 997982222
Species Human (GRCh38) Human (GRCh38)
Location 5:138475429-138475451 5:138475472-138475494
Sequence CCTGTGGAGGGACATCTGGGCTG GATAAAGCTGCTGTGATTATTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 14, 3: 124, 4: 536} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!