ID: 997989686_997989698

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 997989686 997989698
Species Human (GRCh38) Human (GRCh38)
Location 5:138533883-138533905 5:138533927-138533949
Sequence CCTCACATTAATGCCACCCCACT GAGGCATGTTAGGAGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 129} {0: 1, 1: 0, 2: 3, 3: 53, 4: 602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!