ID: 998007225_998007237

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 998007225 998007237
Species Human (GRCh38) Human (GRCh38)
Location 5:138665132-138665154 5:138665173-138665195
Sequence CCCATCCTTGGGGGCAGCTGAGG GCTGAAGGCCTTTCTTGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 257} {0: 1, 1: 0, 2: 0, 3: 18, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!