ID: 998018417_998018424

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998018417 998018424
Species Human (GRCh38) Human (GRCh38)
Location 5:138751259-138751281 5:138751274-138751296
Sequence CCCAAATGCCTCCCACCAGCCCC CCAGCCCCACCTCCAACACTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 74, 3: 646, 4: 1794} {0: 9, 1: 109, 2: 1073, 3: 2912, 4: 4064}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!