ID: 998036719_998036726

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 998036719 998036726
Species Human (GRCh38) Human (GRCh38)
Location 5:138923615-138923637 5:138923651-138923673
Sequence CCTGGGTTCAAGCCATCCTCCCG ATCTGTATCATCCACTTTAATGG
Strand - +
Off-target summary {0: 14, 1: 692, 2: 13812, 3: 172206, 4: 289930} {0: 1, 1: 0, 2: 0, 3: 17, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!