ID: 998037393_998037401

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 998037393 998037401
Species Human (GRCh38) Human (GRCh38)
Location 5:138928549-138928571 5:138928599-138928621
Sequence CCTCTATTTTTAAGTCAGTACCT GTCTTAAAATGCCGGTGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 181} {0: 1, 1: 0, 2: 1, 3: 6, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!