ID: 998037396_998037400

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 998037396 998037400
Species Human (GRCh38) Human (GRCh38)
Location 5:138928578-138928600 5:138928598-138928620
Sequence CCCAGGACAGTTCTCATCTTTGT TGTCTTAAAATGCCGGTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 226} {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!