ID: 998041504_998041511

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 998041504 998041511
Species Human (GRCh38) Human (GRCh38)
Location 5:138953564-138953586 5:138953586-138953608
Sequence CCTGTGTCTGCAGAGCAGCCTGG GAGATGGGCCAGAGTCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 464} {0: 1, 1: 0, 2: 9, 3: 44, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!