ID: 998050315_998050321

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 998050315 998050321
Species Human (GRCh38) Human (GRCh38)
Location 5:139026983-139027005 5:139027032-139027054
Sequence CCTGCCTTGCCTAAGGAGAGCAG ACATCTGCCCAAGATGTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 188} {0: 1, 1: 0, 2: 1, 3: 59, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!