ID: 998055057_998055062

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 998055057 998055062
Species Human (GRCh38) Human (GRCh38)
Location 5:139067717-139067739 5:139067748-139067770
Sequence CCTTGCAGCAACCGGCATCCTAA GGTAAGGATAAATTAGTGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 17, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!