ID: 998056076_998056085

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 998056076 998056085
Species Human (GRCh38) Human (GRCh38)
Location 5:139078632-139078654 5:139078681-139078703
Sequence CCCGATCCCAGTGGATAAAAAAC CCAGGCACGAGGCAGAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 144} {0: 1, 1: 0, 2: 5, 3: 39, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!