ID: 998056077_998056083

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 998056077 998056083
Species Human (GRCh38) Human (GRCh38)
Location 5:139078633-139078655 5:139078670-139078692
Sequence CCGATCCCAGTGGATAAAAAACC CACATCAAATGCCAGGCACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133} {0: 1, 1: 0, 2: 1, 3: 12, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!