ID: 998056078_998056085

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 998056078 998056085
Species Human (GRCh38) Human (GRCh38)
Location 5:139078638-139078660 5:139078681-139078703
Sequence CCCAGTGGATAAAAAACCACTAC CCAGGCACGAGGCAGAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 148} {0: 1, 1: 0, 2: 5, 3: 39, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!